FIRST REPORT OF ALFALFA MOSAIC VIRUS AND CUCUMBER MOSAIC VIRUS IN PEPINO IN TURKEY

S. Özdemir, S. Erilmez

Abstract


In August 2011, unusual virus-like symptoms consisting of distinct bright yellow spots, mottling (calico), mosaic, narrow leaves and stunting were observed on greenhouse-grown pepino (Solanum muricatum) plants in Usak (western Turkey). Leaf tissue from 10 symptomatic plants was sampled and analyzed by DAS- ELISA using commercial kits to Pepino mosaic virus (PepMV), Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), To- bacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tomato ringspot virus (ToRSV), Potato virus X (PVX), Potato virus Y (PVY), Potato virus M (PVM) and Potato virus S (PVS) (Bioreba, Switzerland). DAS-ELISA results revealed that four samples were infected by CMV, five by AMV and one by both CMV and AMV. There were no reactions with the antisera to PepMV, TMV, TSWV, ToRSV, PVX, PVY, PVM and PVS. The presence of AMV and CMV was confirmed by RT-PCR using to- tal RNA extracted from infected pepino leaves (Foissac et al., 2001) and specific primers designed to amplify a fragment of the coat protein gene of AMV (Martinez et al., 2004) (AMVcoat-F: GTGGTGGGAAAGCTGGTAAA; AMVcoat-R: CACCCAGT GGAGGTCAGCATT) and CMV (Faggioli et al., 2001) (CMV- coat-F: AACATAGCAGAGATGGCGG, CMVcoat-R: ACTCT- TAACCACCCAACCTT). PCR products of the expected size (700 bp for AMV and 280 bp for CMV) were obtained from plants that were DAS-ELISA positive for AMV and CMV, re- spectively. To our knowledge, this is the first report of natural co- occurrence of AMV and CMV in pepino in Turkey.

Full Text:

PDF


DOI: http://dx.doi.org/10.4454/JPP.V95I4SUP.020

Refbacks

  • There are currently no refbacks.


EDIZIONI ETS, Pisa, Italy