Archivio Journal of Plant Pathology

Abstract:

The recently described Citrus viroid V (CVd-V) (Serra et al., 2008) has the typical features of members of the genus Apscavi- roid. Our viroid-infected citrus collection which had been ana- lyzed by sPAGE and found to be infected with different viroid species was checked again to determine whether CVd-V was present in Turkey. Viroidal RNAs extracted from 20 sweet orange plants were used as templates for RT-PCR with primer pairs P3/P4 [CVV-P3(h) CTGTGGGTCACCCCGCCC and CVV- P4(c) GAACCACAAGGTTGTTCACC] according to Ito and Ohta (2010). After electrophoresis of RT-PCR products in 1% agarose gel followed by ethidium bromide staining, bands of ca. 300 bp in size were detected in amplifications from five sweet or- ange samples. Amplified PCR products were purified using a Qi- agen gel extraction kit and custom sequenced by Iontec Sequenc- ing Service (Turkey). Nucleotide sequence analysis showed that CVd-V was 294 bp in length. Positive detection of CVd-V was confirmed by sPAGE and SSCP analysis. Analysis of the se- quence of the 294 bp amplicon revealed 96% and 98% identity with CVd-V GenBank reference sequences EU433392.1 and AB560862, respectively. Members of the genus Apscaviroid in- fecting citrus are not associated with diseases but they cause mild stunting and synergistic effects in Etrog citron co-infected with CVd-V (Serra et al., 2008). Since all CVd-V-infected sweet or- ange trees analyzed contained also more than three viroid species, the effect of CVd-V was not clear. To the best of our knowledge this is the first report of CVd-V in citrus trees in Turkey.