Archivio Journal of Plant Pathology

Abstract:

A wide range of foliar symptoms including deformations, mosaic, chlorotic mottling, blotching, vein banding, clear- ing, feathering and chlorotic ringspots, as well as chlorotic ringspots on immature fruits were observed in Tunisian fig trees. The objective of this study was to survey fig orchards for the presence of Fig mild mottle-associated virus (FMMaV) and Fig latent virus 1 (FLV1). Eighty symptomatic and symp- tomless fig trees located at Takelsa, Sousse, Sfax and Morneg were collected in spring 2012. Total nucleic acids were ex- tracted from leaf tissue with the silica capture protocol (Fois- sac et al., 2000) and used in RT-PCR with specific prim- ers (i) FMMaV-s 5’ AAGGGGAATCTACAAGGGTCG 3’ and FMMaV-a 5’ TATTACGCGCTTGAGGATTGC 3 for the amplification of a 311 bp fragment from the heat shock protein 70 homologue gene (Elbeaino et al., 2010); and (ii) FLV1-s 5’ CCATCTTCACCACACAAATGTC 3’ and FLV1-a 5’ CAATCTTCTTGGCCTCCATAAG 3’ for the amplifica- tion of a 389 bp segment from the coat protein gene (Gattoni et al., 2009). Results disclosed 12 FMMaV-positive samples (14%) in Takelsa (5%), Morneg (1%) and Sousse (9%) but not in Sfax while FLV-1 occurred in all surveyed areas (44%) with the highest prevalence in Takelsa (19%) followed by Morneg (10%), Sousse (9%) and Sfax (6%). FMMaV-infected plants showed mild mottling and leaf deformations compa- rable to those observed in Italy on accession Cal-1 (Elbeaino et al., 2010). FLV-1 was detected in symptomless as well as in symptomatic trees. To the best of our knowledge, this represents the first record of FMMaV and FLV1 in Tunisia.