Archivio Journal of Plant Pathology

Abstract:

Grapevine Pinot gris virus (GPGV), a member of the genus Trichovirus, family Betaflexiviridae, was first identified by deep sequencing in vines of cvs. Pinot Gris and Traminer, growing in the Trento's area (northern Italy), and showing mottling and deformation of the leaves (Giampetruzzi et al., 2012). The virus was subsequently recorded from other Italian regions (Emilia-Romagna, Veneto, Friuli-Venezia Giulia) as well as from South Korea, Slovenia, Slovakia, Czech Republic and Greece (Martelli, 2014). During spring 2014, GPGV was found in two distinct areas of Apulia (southern Italy) in several vines of the table grape cvs. Black Magic and Supernova that showed chlorotic mottling, puckering and deformation of the leaves. GPGV presence was ascertained by RT-PCR using specific primer pairs DetF (5’TGGTCTGCAGCCAGGGGACA3’) / DetR (5’TCACGACCGGCAGGGAAGGA3’), spanning the end of the movement protein (MP) and the beginning of the coat protein (CP) gene sequences. The amplified products (588 bp) were cloned into pSC-A-amp/kan and custom-sequenced (Macrogen Europe, The Netherlands). BLAST comparison with comparable GPGV sequences retrieved from GenBank, disclosed that the Apulian virus isolate shares the highest sequence identity at the nuclotide level (94 to 96%) with isolate GPGV ZA505-1A from northern Italy (GenBank accession No. FR877530.1). GPGV involvement in the induction of symptoms observed in Apulian vineyards remains to be determined, for the diseased vines were also infected by Grapevine fanleaf virus (GFLV), whose presence can by itself account for the observed symptomatology. To our knowledge this is the first report of GPGV from southern Italy. It constitutes an alarming finding for a viticultural area hosting a large acreage of table and wine grape stands.