Archivio Journal of Plant Pathology

Abstract:

Castor bean (Ricinus communis L.), family Euphorbiaceae, is indigenous to the southeastern Mediterranean Basin, India and East Africa. India is the world leader in castor bean production with 2.25 million tonnes in 2011, followed by China and Brazil. In March 2013, necrotic spots and vein mosaic were observed on the lower side of the leaves in a castor bean field at the Regional Agricultural Research Station, Tirupati, India. Based on the symptomatology, infection by Tobacco streak virus (TSV, genus Ilarvirus, family Bromoviridae) was suspected. The presence of TSV in symptomatic leaves was ascertained by DAS-ELISA using TSV polyclonal antibodies. RT-PCR using total RNA isolated from leaf tissue by the Trizol method and primers specific for the coat protein gene of TSV (CP-F, 5’AGCAGATGCCCAACTTGTTT3’; CP-R, 5’AAGGGAGCTGGTTTGGATA3’) (Bhat et al., 2002) yielded a product 602 bp in size. The amplicon was cloned in pTZ57R/T vector (Fermentas, USA) and sequenced. The nucleotide sequence was deposited in GenBank as accession No. KC683810. Sequence analysis (BioEdit V7.0.5) showed more than 99% identity at the nucleotide level with 15 other TSV isolates infecting various crops. To the best of our knowledge this is the first report of the natural occurrence of TSV in castor bean.