Archivio Journal of Plant Pathology

Abstract:

Little cherry virus 1 (LChV-1) a member of the newly established genus Velarivirus, family Closteroviridae (Katsiani et al., 2015) is associated with little cherry or shirofugen stunt diseases (Candresse et al., 2013). As LChV-1 was recently detected in Czech Republic and Poland, a survey was undertaken to study its presence in Slovakia by sampling cherries (Prunus avium L.) in various sites (orchards, gardens, old local cherry plantations, botanical collections). Random primer-synthesized cDNA was used for amplification of the putative coat protein (CP) gene (449 bp) using primers 1LC_12776F: 5 ́TCAAGAAAAGTTCTGGTGTGC3 ́ (sense) and 1LC_ 13223R: 5 ́CGAGCTAGACGTATCAGTATC3’ (antisense), newly designed based on sequences from databases (www.ncbi.nlm.nih.gov, accessed on April, 2013). Five of ca. 60 cherry samples tested positive for LChV-1 using RT-PCR. LChV-1-infected samples originated from three distinct localities (Bratislava, Ivanka pri Dunaji, Brdarka) and, in all cases, they were recovered from local genotypes older than 20 years. No typical symptoms could be attributed to LChV-1 in cherries identified as infected, which remained in most of cases symptomless. The partial LChV-1 CP sequences obtained in this work and those retrieved from GenBank showed a substantial variability. Five Slovak isolates were genetically homogenous, showing a within group nucleotide divergence of 1.1% (GenBank accession Nos. KP861749, KP861751, KP861755-57). However, these Slovak isolates formed a distinct phylogenetic cluster, divergent from the previously characterised European LChV-1 isolates (nucleotide identity with isolates NC_001836, EU715989 and JX669615 reached 82.3 – 84.2%). The detection of LChV-1 isolates in old local cherry genotypes and the extent of their molecular variability suggests a long-term establishment of this virus in the country. To our knowledge, this is the first report of LChV-1 in Slovakia.